Counciloris logoCounciloris
Seattle/

Board of Parks and Recreation Commissioners Meeting — July 23, 2026

Video

TL;DR

No summary available for this meeting yet.

No topic summaries are available for this meeting yet.

Summary

We haven't generated a summary for this meeting yet.

Request this summary →

Get updates about Seattle.

Transcript
Unknown Speaker -

Good evening. We're going to try and get the meeting started here. Hello, everyone. Thank you. Welcome. Thank you all for coming to July 23rd special meeting of the Board of Parks and Recreation. We're going to go ahead and get started with some introductions from the board members and the staff that's here representing Sail Park's Direct. This is a hybrid meeting. We do have some commissioners online as well, and I'll ask them to introduce themselves as well and be able to test of our AV system. This is a little bit different than our typical board meetings. It's a single-issue meeting. we're having on the Lower Woodland Park athletic field proposal. So we will not be taking public comments up front as we usually do. We will be taking comments on Lower Woodland Park athletic field proposal after a short presentation that Andy Schaefer is going to go ahead and lead. So with that, let's just do introductions really quick, then an acknowledgement, and we'll start with agenda. My name is Ryan Baum. I'm one of the co-chairs of the Board of Parks and Recreation Commissioners. I'm an at-large commissioner. Just start down at the end of the table. Hi, I'm Brian. I'm the deputy commissioner.

Unknown Speaker -

I'm Brian Kahn. I represent District 6 out of the Rock and Green Ridge. John Flynn, District 3. Thanks for visiting the district.

Unknown Speaker -

Michelle Finnegan, Interim Superintendent.

Unknown Speaker -

Evan Marr, at large, I live in Westside.

Unknown Speaker -

James Jones, at large, I live in Westside.

Unknown Speaker -

James Jones, at large, I live in Capitol Hill.

Unknown Speaker -

James Williams, District 6, I live in.

Unknown Speaker -

All right, and then online, this is a test for A.B. as well. Whitney and Rebecca, can you go ahead and just briefly introduce yourselves?

Unknown Speaker -

Yeah, thanks. Whitney Nakamura, boards and commission seat. and co-chair hi good evening rebecca rash in district one west seattle thank you rebecca

Unknown Speaker -

for joining us all right um we start each meeting with a land acknowledgement so seattle parks and recreation acknowledging and affirms indigenous coast salish people as original caretakers of our waters and landscape who nurtured and shaped today's parkland we honor their legacy with gratitude and appreciation and will safeguard their knowledge and stewardship as enduring treasures to promote community welfare cultivate inclusive expressions of nature and recreation and commit to land acknowledgement for each ensuing generation all right um and um just actually ask the other uh parks uh staff who's going to be here helping us i just briefly introduce themselves

right thank you um andy Ready to go ahead with our briefing.

Unknown Speaker -

I'm Andy Sheffer, the superintendent of the Planning and Capital Development Center at Seattle Park. I'm here today to introduce Seattle Public Schools and their proposal to renovate existing facilities, community facilities, outdoor women park to support Lincoln High School

Unknown Speaker -

athletics, which will serve SPS students and will also increase recreational opportunities for the public. First, SPS is proposing upgrades to the existing

Unknown Speaker -

track and adding field events adjacent to the cloverleaf. We've got a real shortage of field events. Seattle, our track program and Seattle Parks and Recreation, our bus below program. We are supportive of these, the addition of the field events. The field event structure is temporary.

Unknown Speaker -

will be removed after the track season, so that will be an open space. For a long time, we've wanted to make that track and all the other track. It's going to speak well. Seattle Public Schools has responded. We can't review very well.

Unknown Speaker -

We can suggest what our programs are well.

Unknown Speaker -

Secondly, Seattle Public Schools is proposing a location for a new football field for Lincoln High School as well. That football field will also serve the youth in Seattle Park's program.

Unknown Speaker -

These facilities serve all of our kids. We have a shared mission with Seattle Public Schools to introduce youth to athletics and

Unknown Speaker -

healthy living. That's why we have a joint use of green. Again, I am very grateful personally to collaborate with Seattle Public Schools on a regular basis to forward our point of vision to support our youth. We've had several conversations this week on a wide gamut of issues other than the student community in high school supporting better access to facilities.

Unknown Speaker -

The staff's recommendation of Seattle Parks and Recreation to the Board of Park Commissioners is to support the design, permitting, and construction of the track. The renovation of the existing track and the addition of the field. First, second, we support Seattle Public Schools in continuing with an environmental impact statement process for the proposal of the new play field at the 50th and Aurora Park Club at Golden Park. Introducing new assets within our ready-to-date hallways and push and pull. As our city grows, we have increasing demand for outdoor recreation, particularly to support our youth and the need for the woodland environment to ensure that we sustain a livable city. This motion poll was readily apparent in the public engagement process. While public engagement does not only yield support for everyone who views, the engagement that SPS conducted today excited the location of the preferred site. SPS listened and responded to the direction of the proposed site that I pointed out on the video. The most critical friction points requiring this rigorous environmental impact statement process are to remove trees, impact to wildland habitat, impact to existing park uses, including passive recreation activity, active recreation, regional cross-country, cycle cross-races. the EIS must legally analyze and mitigate the spillover effects of lighting, noise, and nearby residential pockets, as well as ensure safe, divestrian routes for students walking from the wall into the campus. Ultimately, the EIS drives Seattle Public Schools and the city to transparently weigh alternative field layouts at the same site and post formal public commentaries before any decision to execute the project is made. That EIS would inform a final decision by Sound Park and Recreation. That's the next major decision by itself as a landowner, ensuring alignment with the goal of integrating the document environmental protection, mitigations, and alternatives. On the topic, as I mentioned before, of the renovation of the existing track and additional field events, staff highly recommend to move forward with that project into design, forming and construction. With that, I would like to turn this over to Richard Best, Executive Director of Design, construction facilities operations. Thank you. Andy?

Unknown Speaker -

Thank you, Andy, for that introduction. I'd like to take a moment just to introduce a few others that are here from Seattle Public Schools. I want to start with our Superintendent Ben Schulberg, Chief Operating Officer Fred Podesta, Executive Director of High Schools and Athletics Chris Carter, and then our High School Principal, sorry, Corey Eichner. So obviously a lot of interest in this proposal that we are coming to talk with you tonight.

Unknown Speaker -

Thank you all for coming and representing Seattle Public Schools.

Unknown Speaker -

And I could get the presentation loaded up.

So why are we here tonight? So, why are we here today?

Unknown Speaker -

We are really here today, Sandy mentioned, to come for you to really seek your approval

Unknown Speaker -

of a proposal for Seattle Public Schools to proceed with an environmental impact statement

Unknown Speaker -

design to build it.

Unknown Speaker -

We are coming before you. Oh, no.

Not, not sticking your phone well.

I know. No, the, uh, the presentation is not full.

Unknown Speaker -

Our first big virtual hybrid public hearing, so bear with us while we try to make sure

Unknown Speaker -

that online.

Unknown Speaker -

It's still showing the intro slide.

Unknown Speaker -

Oh, the slide's not syncing up.

Unknown Speaker -

Just the slide's not syncing up. The mic's.

Unknown Speaker -

Great. Is this better? Yeah. Okay. Okay, great.

Unknown Speaker -

Please continue. Okay, thank you. So we are coming for you tonight, as Andy mentioned, to talk with you and seeking Park Commissioner approval to proceed with an environmental impact statement and design activities for a field that we would like to place at North 50th Street at Aurora Avenue.

Unknown Speaker -

And then we're also coming for you tonight to seek water approval to

Unknown Speaker -

construct a track and the associated field events at what I refer to as

Unknown Speaker -

Lower Willen Field Number 7.

Unknown Speaker -

So, just to give you a little bit of background as to why we're here, this was a process that Seattle Public Schools started about two years ago. We've had extensive community engagement on this process. We had a meeting that we held on April 25th, a little bit later, we really demanded a location for the field at North 50th Street and then for Avenue to the west. We have really exhausted our other locations. One of the reasons we landed here is that it meets the criteria that was identified by the District Athletic Department, by the Lincoln High School Athletic Director. But we also recognize that this is a wooden site and that we have tree mitigation that we are going to need to consider in our proposal, hence the environmental impact statement. But we have forest canopy that we are going to need to consider in our environmental proposal. In addition, it talked about the wildlife design at Woodland Park, total Woodland Park. We recognize that we are going to have to address that in our proposal as well. and Ian talked about partnership Seattle Public Schools, Seattle Parks and Seattle Parks and Seattle Public Schools are really our organizations are intertwined. Many of our schools have parks immediately adjacent. Some of our properties are checkerboard. And it's surprising to know what Seattle Park zones. and what Seattle Public Schools is. Great example being Catherine Boyne and K. But I just want to again highlight the partnership that Amy talked about. Recently, we completed an athletic field in High School together. We helped fund the athletic fields here at Miller Park, at Hiawatha and Jefferson. and we literally reach out and meet on a monthly basis with a team of folks from Seattle Parks and Seattle Public Schools. We need to make sure that we are coordinating our use to minimize our impact on the community. When we take the field offline, we don't want it to be in the same location of the city that Seattle Parks is taking the field offline. That's a big impact to the community, hence why we need a monthly basis.

Some of the project drivers on this project were that we wanted to make sure we had a field that could support football, that could support soccer, that could support ultimate. And so we have landed on a size of 195 feet by 235. We think this is consistent with the uses that Lincoln High School is going to need. We wanted it to be a walkable location to Lincoln High School, making it a lower Wilma Park has a long history of activities for Lincoln High School. athletics and so kids walk there again back from the 1980s to this field for athletic pieces. We also want to look at some of the facilities that are there. We know that there are rescue facilities. There's going to be a need for rescue facilities. We know there's going to be storage facilities. We'd like to provide the opportunity for spectators to watch their son or their daughter play in a field in varsity games. That might be his . That said, we talked about and heard the community constraints, the concerns about tree removal. We want to recognize that going in. We know that we're going to have to remove some trees. How do we mitigate that? how to look at the orientation field and minimize that. Those are things that we have not yet begun to do in the design process, but we, again, know that we need to do that level of work. Also about the forest canopy, and I'm going to hit on those because I know there's members of the audience that are concerned about that. We're aware as well. I've had the great prior of working at Seattle Public Schools for 12 years. We have designed a lot of schools in my tenure here at Seattle Public Schools, and I think our projects have been highly successful, and I want the same outcome for this.

Unknown Speaker -

We do have budget limits, and we do have lighting impacts. One of the things that I will highlight

Unknown Speaker -

of lighting is the new muscle LED lighting. It's very directional and we can minimize the

Unknown Speaker -

full candle at the property line and the spillover. 10 years ago, 20 years ago, we were using metal

Unknown Speaker -

power light. That wasn't an opportunity. We didn't have that opportunity to do that. There was a lot

Unknown Speaker -

of spillover. But with LED technology, we have great directional light. So we can minimize the for campus that are going to spill over.

Unknown Speaker -

Look back, I'm going to say that my staff started with an exploration of nearly 20 various sites throughout and nearby Lincoln High School. We looked as far away as Montlake, Magnolia, we looked at the Pan Am Hall, but really we kept coming back and the driver of it needs to be in a walkable location in Lincoln High School. Lincoln High School students today are driving approximately 30 minutes to our Robert Eagle Staff Middle School field, a little bit further to our Ingraham High School field, and that impacts upon the education program, that impacts upon the athletic program, and so that was a huge driver for the selection of this site. We did come together with a proposal to look at Longford Clayfield. What we heard from the community when we were looking at Longford Clayfield is that the proposed field is too large. It will dramatically change the character of the park. And the community said, can you look elsewhere? Some of those community members highlighted the Overfour parking lot at Lower Woodland. We came and looked at the Overfour parking lot. We also looked at another location at Lower Woodland adjacent field number two. Again, what we heard from the community, we've got two fields located side by side. They're two crowded. We'd like you to really explore the opportunity to build a field at North 50th Street and Aurora Avenue. Thanks.

Unknown Speaker -

So our feedback, we have been in several public meetings.

Unknown Speaker -

We have gotten feedback from various community groups throughout the city of Seattle, the

Unknown Speaker -

BIPERS, Tree Climate Action Group.

Unknown Speaker -

We are very aware of these areas that we're going to have to mitigate in our project when

Unknown Speaker -

we go into design and construction, and we will address them in our environment.

On April 25th, we held a meeting at Hamilton International School. Approach 300 members showed up and this is really where we talked about the field of lower woodland, field number two, we talked about the 50th and Aurora site, and then we also talked about the track and field event improvements that we're looking at making a field number seven. Not much controversy at all about track and field. Really, the comments that I received, staff have received, have really not spoken with any concerns expressed of the track and field. So we're asking tonight that we're asking for approval of the track and field events going as a separate project.

Unknown Speaker -

Just a point of clarification, we will not be voting on approval tonight. That is currently scheduled an agenda for our Thursday regularly scheduled board meeting. This is just a public hearing on the topic.

Unknown Speaker -

Thank you. So these were really the three options that we looked at on April 25th. We looked at, as I said, a side-by-side option located at field number two. We looked at a standalone football, soccer, but we also used ultimate, most likely lacrosse as well, at 50th and Aurora. And then we looked at could we enhance field number two for football, created a soccer field at 50th and Aurora. Overwhelmingly, we heard that 50th of Aurora would be really positive to activate that. That is an area that has had security issues and the community that showed up overwhelmingly in support of option B. That is not to say that there weren't supporters for option A. Option A is a little bit faster for us to implement, and there are also supporters of Option C, but the majority are in support of Option B.

Unknown Speaker -

So as I highlighted, the top takeaway brought us support option G. Again, I want to highlight

Unknown Speaker -

what we did here, concerns raised on the trees, about parking, about pedestrian safety, and

Unknown Speaker -

we'll be definitely addressing those in our environmental impact statement and our design

Unknown Speaker -

So our question tonight is again, I know you won't be voting on it, but our request is that you can

Unknown Speaker -

go forward with the design permit and our full size multi-sport athletic field at North 50th Street,

Unknown Speaker -

And to be addressed during the design phase, I talked about this a little bit, but during the environmental impact statement, you know, we want to develop strategies for mitigation. We want to look at field orientation. We believe field orientation is critical to mitigating tree removal. Obviously, you have to do that in concert with looking at the sites and potential for the painting walls. But that is something that we need to study and study deeply. We need to have conversations with Andy and team about what the storage facilities look like for Seattle Public Schools, Lincoln High School. What type of things do we need to store there? How much space exists today? we need to look at the rest of the facilities as well. And then at the end of the process, we need to develop an operating agreement so we understand who's going to be the first. It has a lifetime of 10 to 12 years based upon use. Our fields are heavily used as Andy highlighted. a community does not have enough fields for use, so we think this is a benefit to construct another field.

Unknown Speaker -

We'll definitely be placing lights on this field to allow that to be extended into the nighttime.

Unknown Speaker -

So these are just some possible field orientations.

Unknown Speaker -

You know, we will definitely be exploring an east-west orientation, north-south orientation, and then potentially even a diagonal orientation so that we're minimizing tree removal. One of the things that we know on site is access the southern portion of Lower Wilhelm Park from 50th. Is there a way to combine those accesses rather than have two entry points, one plant additional trees at that second entry point to the west?

Unknown Speaker -

Emergency vehicles, we know it's get injured.

Unknown Speaker -

Community members get injured on fields, so we definitely want to make sure that we are thinking about emergency vehicle access to those fields as well.

Unknown Speaker -

From a permitting standpoint, environmental impact statement is a significant endeavor, but it is not the only endeavor.

Unknown Speaker -

You will have to go through a City of Seattle additional use permit, a Department of Ecology

Unknown Speaker -

NPDES, National Pollution Discharge Formation System, will have to secure that permit, building

Unknown Speaker -

permits and then also a mass-produce permit for the highest flights.

Unknown Speaker -

Looking at a rough timeline for this project, with your approval, we'd like to begin design and our work on the environment impact statement will definitely be engaging in conversations.

Unknown Speaker -

We think the design and studies period is probably a two year period.

Unknown Speaker -

Permitting will take a significant amount of time as well, the city and Seattle permit process. And then we believe construction will take 12 months as well. Looking at roughly 2029 timeframe, we'll be looking also at how to be expedited. What measures can we do to potentially bring that so we can get the field views?

Unknown Speaker -

The second proposal we talked about is the track. We would like permission to proceed with the track of design permitting and ultimately construction.

Unknown Speaker -

We talked about the reasons why I have not really heard much feedback on the track.

Unknown Speaker -

This will take field number seven off on the summer by implementing the track improvements. And so we want to create more.

Unknown Speaker -

Again, as Andy highlighted, we're looking at putting a track around the perimeter of Field No. 7, and then field events to the south. Field events will be out in the spring and then be placed in the storage. nd then placed in the storage facility and not use when it's not tracked. ! Again, we have some permits that we're going to secure for this project as well. ! A CEPO permit, City of Seattle condition use permit, and then a building permit. We do believe that we can complete this project in a more expedited time. that we can complete this project in a more expedited timeframe, and that's why we want to separate them so we get the benefit of utilizing this track, potentially, a year earlier. I will highlight Lincoln High School has a very active track program, and it really serves 40 people to chance. A couple years ago. That's like, I'll say change.

Unknown Speaker -

So, in summary, we are looking at the post-gen, hashtag, so forward with our two proposals.

Unknown Speaker -

We'll see with the environment, one of that statement,

Unknown Speaker -

and then we'll speak with the design and ultimately construction.

Unknown Speaker -

For next steps, we know we're going to have continued to work with Seattle Parks and Rec. Andy and I

Unknown Speaker -

talked frequently, not frequently prior to this effort beginning, but we talked more frequently now.

Unknown Speaker -

We would like to begin the design for the field of contract innovation, hire a consultant

Unknown Speaker -

to perform the EIS, and then we highlighted just a small group of folks that we need to

Unknown Speaker -

connect with as we move forward with this project to make sure that we're hearing their voice and can address that.

Unknown Speaker -

With that, I'd open up potential questions.

Unknown Speaker -

So just to reiterate, the request is for Seattle Public Exclusion to move forward with the traffic field project and to move forward on an EIS process for the proposed new field. I apologize. You're absolutely right. Our supply of kids does not meet the demand. And if we don't have enough table vaults, we don't have enough force to have it. And it's equally, we hear people about that as well. And I'm a huge fan of PIS process case. We use them a lot in Seattle parks. It's very surprising, the results. In some projects where I think this is very straightforward, we do this EIS project where the infrastructure in a year and a half, you know, I've had projects stopped. And in other cases where it seemed really obvious that what the environmental impact was going to be, I was surprised by the level of mitigation. The other thing that's really important in EIS processes is that there should design come from. Is this the best design to reduce impact? The slide there with the orientation feels very obvious. There's ways to manipulate the orientation and the cut and fill to reduce impact. That's what it's all about. A lot of the comments we've posted, the 30 of the comments we've received, questions would be better answered by subject matter experts. That's an EIL. you have the subject matter experts responded to those specific concerns definitive and

Unknown Speaker -

i think that gives you the clarity you need to go and then andy um in our next board meeting you're you're going to give a short basic recap the presentation we're going to take questions

Unknown Speaker -

if needed okay anyone have any questions time one clarification so will the i ask be responding to a proposed single playfield layout or will the EIS actually look at just submit all three with enough detail to show trees where other like it's this weird thing of how do you design it without the EIS how do you do the EIS without design so sort of a schematic level design that goes to the EIS

Unknown Speaker -

So I'll note that generally EIS is local. We'll look at two or three locations there. We'll probably have three alternatives to look at, plus the alternative which you require. Thank you. Other questions?

Unknown Speaker -

Thank you. I mean, we gathered to have this hearing to hear from members of the public.

Unknown Speaker -

So the next item on our agenda is comments on the proposal for the lower Woodland Park athletic fields.

Unknown Speaker -

Ben or Paula, can you just give a brief overview of the public comment procedure just before we start?

Unknown Speaker -

At the mic, please. Oh, sure. Yeah.

Unknown Speaker -

I have a comment. We are skipping the topic.

Unknown Speaker -

And we'll have two minutes. And we'll give you a little bit.

Unknown Speaker -

There are some online as well.

Unknown Speaker -

Okay.

Unknown Speaker -

And you have the comments in order, sort of people signed up, roughly, is that correct?

Unknown Speaker -

please as much as I could in the order that you can find out the comments. If you did not submit a request in the in time for me to get that in there, my apologies. We are limited by the statistics of the time. You are also following the subject comment via the written comment to our PKS underscore VCRC email address and those do get sent to all the board members and they are instructed explicitly to wait those exact same and oral comments. We have 32 sign-ups for public comments today, two minutes each. You can do the math. We do ask you to remain very quiet during this process. We do not have air conditioning in this room and I'm sure you all are feeling not the same as we are. Maybe you all didn't press the slide or try that.

Unknown Speaker -

Alright, thank you Ben. And just to reiterate, those written public comments they are sent to all commissioners um we read through i promise i read through all of them um there have been several hundred comments submitted uh online we do get all that we do process that we do take that into consideration as much as um any comments submitted obviously not everyone can be here um in person so um those comments are valuable uh as well um the one other uh nuance um are for anyone who's online listening to this if there is clapping or loud noises, the way the mic works is it will pick up that and basically not be able to hear anything else. So I do ask folks to try and be respectful. I would really prefer

Unknown Speaker -

not to try and cut people off. So if you're able to stick to that, to MITLIMIT, we really

Unknown Speaker -

appreciate it. And who do we have first for public comment?

Unknown Speaker -

I'm going to give you the first read.

Unknown Speaker -

Oh, great.

Unknown Speaker -

First, I think that's fair. .

Unknown Speaker -

All right, just please ask you to come up with the mic. There are folks obviously online listening as well.

Unknown Speaker -

That's what he just said. I'm going to read off that poem.

Unknown Speaker -

The words that I just spoke to you are .

And also my big, big grandson, she's Seattle. Seattle, as we know it today, is going to be that these trees that have been on you for a long time,

Unknown Speaker -

they're starting to go away. But we as Native people realize that when we pass away we end up

Unknown Speaker -

back in the streets. It's a simple science project everybody can verify it. And so I'm here to advocate

Unknown Speaker -

for the streets. That's not to say we shouldn't have these

Unknown Speaker -

fields. But what I'm saying that what's in these streets is extremely important to the Native people's land.

Unknown Speaker -

And so presentation of that is up to us. So thank you for your time.

Unknown Speaker -

Thank you, Commissioner, for holding this public hearing. I'm Sandy Shetler with Tree Action Spout.

Unknown Speaker -

This project has become the conflict between legitimate community interests. The neighbors are concerned about traffic. The BMX community wants to preserve its space. They can hire students on a home field. Everyone is here because they're trying to protect something they care about. But beneath all these interests is one thing we all have to do with, a healthy environment.

Unknown Speaker -

These new churches are not just family, they're a fellow country researcher. They rule our neighborhoods, which is going to be important, and protect people during extreme heat.

Unknown Speaker -

Every person in this state depends on the benefits those trees provide. That's why the true impacts of Option B matters so much. Last November, the school district only consulted the patient eagerly, we do not intend to recommend Option B, but it's far too impactful.

Unknown Speaker -

Since she made that statement, the field has not become smaller, the rating has not changed,

Unknown Speaker -

yet the estimated tree loss has somehow dropped dramatically. When we asked for the tree inventory and project over by supporting these new numbers, we were told that no specialist exists.

Unknown Speaker -

Looking at the site with trees in the lot and forests in every direction, it's clear that no orientation of the full-size athletic field would avoid massive loss.

Unknown Speaker -

Please bring the school, the neighbors, the B&X community, and parks together to find a solution at Lower Wilhelm,

Unknown Speaker -

where athletic fields already exist and recreation infrastructure is already established. When everyone gives a little, everyone

Unknown Speaker -

benefits. But when we ask the forest to give everything,

Unknown Speaker -

we all please. Thank you.

I know we're all here to advocate for our kids now and in 2029 and beyond. I'm Sarah Lapis, I'm an SPS parent and project director for the Robert E. San Francisco. With that same commitment to the future, we must honestly consider a proposal's environmental and public health impacts. As my colleague Sandy shared, there is no realistic way to build a site that I feel that this site is out-of-the-day loss. And those losses are not abstract. Science is clear. Removing large, healthy trees and replacing them with pavement or artificial turf causes immediate and significant warming, up to 20 degrees or more on our high states. Tree canopy cuts urban heat island impacts nearly in half. Seattle is already fifth-worst in a nation for urban heat islands. we can't afford to remove large portions of one of the city's healthiest, remaining forests. Most importantly, there is no planting plant that can replace what would be lost even if every seedling survives. And increasingly, they don't, due to the very heat stress this project would make worse. If the new trees live, they won't provide the cooling benefits these large trees currently offer in our lifetimes or our kids' lifetimes. Meanwhile, as we've all felt this week, Our foot waves are becoming more frequent and more extreme. Our children are watching the decisions we make. Someday they'll ask us, when the hottest years on record keep happening, what did you choose? Did we remove healthy living forests and replace them with hot cage and plastic surfaces? Or did we have the courage to protect the irreplaceable natural infrastructure that protects us? I hope our answer is one of the things we have.

Next up.

A little louder, Paul?

I can hear a mask of your eye hair.

Yeah, let's fix it for you.

Okay, can you green out? Is that better?

Sorry. John, the green light's flashing. Is that...

We were able to hear you, I'm sorry for the audience, unfortunately.

Unknown Speaker -

This is Debbie Dixon, I'm from the board of the regiment, and I'm stunned to read the

Unknown Speaker -

In 1903 John Olmsted wrote, In 1903, John Olmsted wrote, quote, this portion of the park is covered with remains of native woods, which requires it sufficient to preserve typical pink- ! which won't float the entire region. Upper Woodland is a treasure. It's one of those few places in our city where we can be surrounded by native trees and vegetation, which is the sand and the section. Walking through the trails here puts you in touch with nature. This is where we took our children to see owls and bats. trails here puts you in touch with nature. This is where we took our children to see owls and pets. It's where they heard to ride their bikes, diligently moving slopes without training. It's a space that after a snowfall transforms it to the middle of life, lighting sweaters, and plastic. But mostly, it's one of the few places in North Sea and a mile that one can go to experience nature and perceive. Other than it is also an important had a tough fight with a new village. This was really going to spread out. The proposed design would not only be able to offer 75 native trees, more and more pure, but including massive red stairs. It will require excavating many, that says in some places over 35,000 cubic yards of soil, put an even more tree to set this in any of the ultimate graves. The space

Unknown Speaker -

even the schools' district consultants

Unknown Speaker -

protected the sector for the reduction in AA. and which understand actually

Unknown Speaker -

that people work in the program. Thank you.

Unknown Speaker -

Ok. Ok. Ok. Ok.

Unknown Speaker -

My name is Chris Wallace, and I am a retired attorney, long-time resident of Seattle, and a long time ago I was a city attorney, but my time was the Parks Department.

Unknown Speaker -

So it runs around sometimes, or so. So I went to the site to the Southwest Department of the Living Park. And yes, it's being used as a gravel parking. I think it's a terrible sign for those words. But when you look around, you see a lot of gorgeous trees. You see maple trees, bird trees, cedar trees, all around the edges of the lot. And there are a few spaces in the lot itself. It's a beautiful sight. And you can't improve on those trees. I look for Shepard and I hope he talks about the robust investment in the tree canopy and some extended tree established in periods. I don't know if they're doing shammies, but I suspect what he's saying is, we're going to plant some zapplings, some small trees when we take out the big ones. Well, that is going to be nothing. That is just a recipe for a complete disaster. We've got the category we need right now. And I think the school should reconsider what it's doing. But that's another athlete. It's learning students. I'm not denying it. It's kind of important for those kids to get the registrars to get that.

But it's not for us to take both frees away. And when you do that, we are dropping the terrible burden.

And so, thank you for your afternoon, Steve.

Unknown Speaker -

Thank you.

Hello, Commissioner. My name is Zoni. And I am assistant coach at high school football in the high school.

Unknown Speaker -

So, 16 years. I was an avid sharewarn, one of those sharewarns.

Unknown Speaker -

I planted a lot of trees. I'm all thinking about plant trees. I just wondered, is there room for trees for children? I painted a future grade in 1907, Lincoln High School was born.

Unknown Speaker -

And it was closed for four years, plus it didn't work out. 1927, woman by the name of Ellen Bailey,

Unknown Speaker -

you might go to Ellen Bailey Park. So if you see, I don't want to, Eric said, we'll give you $3,250 to buy another piece of land. And she said, I'll sell it to you.

and then in 2007 disarray and so this board and this community got together and we built the same agreement that was clear time discovery was clear time 526 buildings abandoned a million men went to a war 600 students didn't come back and built a memorial stadium discovery rooms for children and trees these are holy kids my son's a building kid I want more sports and less friends. He's 36 hours a day. He's supposed to sleep 10.5. He's up at 6 o'clock in the morning. He doesn't get home until 10.30. We go to Lincoln High School, we get kicked off the field. It's just a little lower room. Three weeks ago, we were asked to move four times. And our full football player, our frisbee team, our adult baseball team, our soccer team that have bought the field. and then we have to go out and compete against other teams. And you know what keeps our doing with Lincoln High School? We're the biggest high school in Seattle. We have a smallest facility we opened seven years ago, no fields. We are failing kids. We are failing mental health. And I'm telling you right now, there's room for trees. There's room for children. My attitude is gratitude for all of you. You're here for three years. You do it free. Let's work together in the spirit of another family and look down and see kids playing, adults playing frisbee, and children's brawl.

Unknown Speaker -

Thank you so much. Appreciate that.

Unknown Speaker -

Thank you. I'll be like Andrew Segal.

Good evening. I'm the state holder. I'm a resident of Seattle. I'd like to start with the civics lesson. When Washington became a state in 1889, part of the funding of the schools came from cutting down trees. Unfortunately, I had practice for it first. The kind of lesson we were teaching our children,

Unknown Speaker -

we cut down trees so that we couldn't follow our education. I think that is wrong, and I hope that most of the people in this room think that is wrong. The fund schools by cutting down trees is just wrong. Similarly, I've laid it as Bonnevacup Charm Trees, a large grove, to build a sports field. There are other options to set the sports field, but the superintendent chose the one that has the largest environment, a large slosh of trees. Again, what kind of lesson is this? The lesson is, if you need space to build something, then we'll just cut down the trees. Another civic lesson. For many decades there used to be hydroplane races on Green Lake. The community proposed this activity for quite a while to no avail. And in 1984, a baby snow leopard died in the zoo with direct correlation to the hydroplane race. This led to the end of the hydroplanes at Green Lake. This inChinatown-International Districtent prompted me to question the potential impact of locating a sports field adjacent to the zoo. What are the consequences for the animals? They can't leave when there's a football game. This is their home. We need to protect it. And what are the trees and what are the animals and the trees that are cut down? And what about the humans? The residents of Seattle have not to walk through this part of Brooklyn Park

Unknown Speaker -

and take the majesty of the trees.

Unknown Speaker -

As we grow our city, we need work parks for trees. If the city, the schools want you to do just the opposite, I ask you to look at plants without such a large environment to impact. Believe me, I love sports, I love football, but we can do both.

Unknown Speaker -

Thank you. Next.

Thank you all for holding this hearing, and thank you all for your discussion. I am a parent of six, a law professor. Three of my kids are at Lincoln now. One is a graduate of Lincoln. They had very different experiences, and I want to talk to them, talk about them, talk about it briefly. To put it simply, I've been involved in this district for a long time, and one of the great successes that we've seen is Lincoln High School.

Unknown Speaker -

Quarry when it was opened, we needed another high school to fill it. Lincoln has been a success in every level.

Unknown Speaker -

It's the largest in the city, academically successful, wanted to do social and emotional learning, bring college placements, bring a sense of community. The one thing that has been missing and one thing that was promised was equity with the other schools in the districts in terms of athletic fields so that the students didn't have to make sacrifices that were in the mentor of what other students did in order to access these wonderful communities. Funds were set aside, the process was sorted, and it's been delayed and it's been delayed. I want to speak to the costs of that. The costs of that are the emotional, mental, physical health of our students, to their early sleep, to the hundreds and hundreds of hours that parents have spent tracking their students, driving their students, creating more traffic to get their students to further away fields. And the valuation of our time, of evaluation of our student's mental health has not entered into the process of how to do, what to do, when to build a field, how to push it through, to the degree that one would fund. Students haven't been treated as full members of the community, other interests have been forwarded, which is being a whack-a-mole, every time a program proposal was put forward, an idea or location was suggested, another reason was come up with for why this location It's time to move forward in the process, to issue that permits, to approve the track, and to keep going with the promises we've made. Thank you.

Hi. Thank you, Commissioners, for the opportunity to speak to you this evening. My name is Beth LeDoux.

Unknown Speaker -

I'm a resident Seattle, proud grad of Rosell High School.

Unknown Speaker -

But I am now finding myself as the co-president of the Lincoln High School TSA.

Unknown Speaker -

I am here to voice support for moving the Lincoln Athletic Field Project into environmental impact.

Unknown Speaker -

It's unfortunate to see that we're doing a trees versus field discussion because it's more than that. about following through on a commitment to voters and your students. I work in environmental sciences in the public sector, and I know that any public project of this size will come with impacts. There is no perfect location that won't have impacts. And in fact, not doing the project has its only impacts, even environmental. We're asking a student body of about 1,800 students, 50 to 70% of which participate in sports. They're driving 30 minutes to fields all across Seattle. We know this has two impacts. We know that this has tire dust impacts which has recently been led to the depths of the sand and the streams. There's just impacts relations to these types of projects. But one thing I know is that impacts can be mitigated. And the EIS process provides clarity and transparency by weighing product impacts against product benefits while identifying and exploring reasonable alternatives and mitigation techniques. We need to trust this process. The voters approved the building of Hennigan Field in 2014 and 2022. We have exhausted our options for other sites. It is time to fulfill our commitment to the voters that made our promise to be safe. Thank you. So, Siobhan? If I call it?

Unknown Speaker -

Siobhan? Did you hear that right? Oh, thank you. When I see that you are not in mind, I will hear the instructions there.

I'm not going to need something to illustrate how to do it. I care about this for vulnerable because I plan to play soccer for the next year, and having a dedicated field will improve the experience of school sports, not just for me but for everyone. Having a field gives us a place to consistently practice with no students from outside schools having priority of the field. This will also save us the time of grabbing the angle, giving us more time to practice and to homework. Thank you for listening. I hope

Unknown Speaker -

you consider approving this. Ellen, I will give you permission to unmute yourself. You will still to do that once you begin we will start the clock for two minutes.

Unknown Speaker -

And Dork, you'll be next.

Unknown Speaker -

Ellen, I think you just muted yourself again. You need to unmute on your end, please.

Unknown Speaker -

Hello. Okay, go ahead. Okay. Good evening. My name is Ellen and I'm a Seattle resident.

Unknown Speaker -

I'm concerned that the current proposal will have the greatest environmental impact among the options considered.

Unknown Speaker -

It will remove many significant mature trees. And after the recent heat we experienced,

Unknown Speaker -

I think we should be protecting, not removing the shade and the crawling these trees provide.

Unknown Speaker -

I think these mature trees support students' physical and mental wellbeing, not just the environment.

Unknown Speaker -

So once they are gone, they cannot be replaced in our lifetimes.

Unknown Speaker -

I hope we can find a solution that meets students' needs without asking our urban forest to bear the greatest cost.

Unknown Speaker -

Thank you.

Unknown Speaker -

Thank you very much.

Unknown Speaker -

Thank you. Thank you very much for always reading the literature and use words. ! I've always emphasized that I know what they can follow in our minds. Time on the field builds physical and mental health, confidence, resilience, discipline, and friendships. There are lessons that are camped each month in the classroom. They're earned on a team, hard work, setbacks, and injuries. We've heard that Lincoln is the largest comprehensive high school in Seattle and the only comprehensive high school in the outfield. But you might not understand exactly what that means for families. Because Lincoln doesn't have its own field, many of our teams have to practice at 6.25 every morning. actactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactact have to practice at 6.25 every morning before school, five days. Traveling to Longwoodland may not feel so bad if you live in Longwood or Criminley, but many of our students are traveling from every morning and in the morning. This schedule makes it almost impossible for students who don't have their own transportation to be able to participate in a sports program. We should not be asking our students to be getting up at 5.30 in the morning. Ironically, it's the fact that the Scala Public Schools moved away from when they delayed high school start times. Research shows teenagers need more sleep to sleep in school. Many lengthy teams, including football, track, marching band, carl bus, across the city as we've been hearing. We've done the math. The average lengthy football player spends approximately 220 hours riding buses in a single season, getting just two and one practice. That's equivalent to 33 full days of school. That's time they could be spent training, studying, resting, or simply being a teenager. I'm asking you to move this process into a very new job. Thank you.

Unknown Speaker -

Hello, my name is Sue Nichol and I'm honored to be the members of Seattle's Old Stead Parks. This project will end for speed, impact the very woodland nature of the woodland park, one of the previous Old Stead Design Parks in Seattle.

Unknown Speaker -

At this point, the true impacts of auction-to-punch, we cannot be adequately understood because the design is not sufficient. For example, we are shocked at the potential loss of 40 to 80 plus mature and healthy trees in an area intended to be part of the parks.

Unknown Speaker -

You, the Board, need to be the steward of the entire park system and resources, and not cede responsibility for such a large area of Mississippi Park School District for a restrictive use. The design should not be left in control of the school district alone. Parks and Park Commissioners need to have an active role to ensure there is no project and you are the key to this process and we ask that you ask hard questions and get real answers to the design of the field and this is especially important

Unknown Speaker -

in light of the unknown outcome of a city council vote on the council bill 12-12-15 which will eliminate the public's ability to appeal the environmental compact

Unknown Speaker -

We are very pleased to see that option A and the LA of old 100 year old plus

Unknown Speaker -

indentures along the way will not be impacted because loss of these historic trees is frankly

Unknown Speaker -

not an negotiable status. With that caveat we believe it would be important to continue evaluation of our time to confirm on site because we believe we need field dimensions.

Unknown Speaker -

I'm sorry thank you.

I'm sorry now.

Unknown Speaker -

I'm Bruce Heidelson, and I also represent the board of the Friends of Seattle's Woodland Park. I want to read a quote from John Charles Olmsted to describe the vision that we have for Woodland Park. He says, one of the most essential landscapes, especially for Woodland Park, is the woodland from which the landscape is one of the most interesting and refreshing sorts, as it forms a great contrast to all the ordinary cities of the streets of the park. In the case of Woodland Park, the wild beauty of the woods is very remarkable, and every effort should be made to preserve it or make it it conveniently accessible. So although the proposed ball field, like I mentioned, the degraded area of parking, which by the way I don't think was part of the original plan, I don't know the history of how the parking lot of the problems, and the anthropology development appears, but the problems once this is done, we're losing forever the free camp of the potential of that entire area. So please keep that in mind if you're going to make decisions here. We also want to mention that there are issues which are obvious about grading the site. It's much more complicated than option A because of the extreme amount of care that needs to be moved. We don't have time here to get into it, but we have some ideas if you proceed with this to potentially reduce the impact on the site by leveling that out a little bit and not taking as much on the west and leaving more impact on the other side. But regardless, it's a huge impact on that space. We would urge you to reconsider options. Sue and I actually blocked the site and measured. We have some ideas on option A that could work and potentially have much less impact and, importantly, much lower cost than option B because of the rate. I thought it feels already impacted. Thank you very much.

Unknown Speaker -

Thank you.

Unknown Speaker -

This proposed project is a project of cost cost.

Unknown Speaker -

But tonight I'm going to focus on the topic that two people had last talking about, which is the funding of this project.

Unknown Speaker -

Clearly this project is estimated at a cost of over $9.4 billion cost. Does the school district count the funds needed to proceed with this project and not set for it as a cost? The Parks Department will also need a sufficient budget to cover the cost of the people who

Unknown Speaker -

The park has been in the development of projects built in the review. It is not feasible to allow the school district to take on to a doubt by the public concerns regarding impacts of the environment for the fully involved public. This project grants transparency and inclusivity for such an important decision regarding land use of public park. The Parks Department indicates that it will take on the cost of maintenance for the project after it is built, What will that take away from other department obligations? Should the school district have to contribute and really to cover that cost? How will the field be used by the public? It is primarily for practice for weekly high school students and not for smaller footprint. What's the environmental impact? These are just some of the questions that need clear answers. The programs commissioners need to retain an oversight rule to continue to get sure to ask the right questions and ask.

Thank you.

Unknown Speaker -

Thank you very much.

Unknown Speaker -

Good evening, Commissioners. My name is Clay Packard, and I'm the head football coach at Lincoln High School.

Unknown Speaker -

When I spoke before you this year, earlier this year, and many tonight, we've all described the challenges Lincoln students face every day simply trying to reach a place where they can practice. Tonight, I want to focus on gratitude and the opportunity now for us. Thank you to the Lincoln coaches, all the Lincoln coaches, and the school administration who have continued to advocate for our students.

Unknown Speaker -

Thank you to Seattle Public Schools Superintendent, Ben Shoulder, for supporting this effort. And thank you to all the parents, families, and community members who have given their time, energy, and voices to get us to this moment. Your commitment to young people and their future well-being is inspiring.

Unknown Speaker -

But gratitude must now be followed by action. The next step is here. You have the opportunity to create a new asset for the community, one that will support

Unknown Speaker -

not only Lincoln students, but young people, families, teams, and activities throughout our community for generations to come. For the waves of future Lincoln links, this field will be more than a place to practice or play. It will give them a sense of home, it will teach responsibility,

Unknown Speaker -

and it will create pride in their school and their community. Whether it be my two sons or the kids I'm blessed to coach. I constantly preach legacy. Be the community member others look and strive to emulate. Each June at camp, our players huddle together and define legacy for themselves,

Unknown Speaker -

laying the foundation for the year ahead. Moving forward, commissioners, now is the time for you to define your own legacy. Thank you for your time.

Unknown Speaker -

Followed by Paul.

Unknown Speaker -

The irony of a meeting about Lincoln's fields being held at a way field is something that O'Henry would be proud of.

Unknown Speaker -

Esteemed members of the Parks Board, my name is Lieutenant Colonel retired Jason Garno, and I come to you tonight as a concerned citizen, Lincoln's head wrestling coach, and someone

Unknown Speaker -

who will be a Lincoln parent for the next seven years.

Unknown Speaker -

When I retired from the Army, my family and I chose to settle in Kenan, mainly for the

Unknown Speaker -

quality of school that our children would attend, including Lincoln. Our experience at Coe Elementary and McCord Middle School have thus far been nothing short of exemplary. It was my daughter, an incoming freshman at Lincoln, who discovered the job posting for the head wrestling coach at Lincoln,

Unknown Speaker -

knowing that I've wanted to coach high school wrestling since my time as a volunteer wrestling coach while teaching at the United States Military Academy of West Lincoln.

Unknown Speaker -

What I've seen in my short time in the area and in this school is that while the academic program at Lincoln is absolutely top-notch, Surprisingly, despite the fact that Lincoln is the largest and only 4A school in the city,

Unknown Speaker -

it is the poorest resource when it comes to athletics. From a personal standpoint, this means that the wrestling team shares and competes for practice space

Unknown Speaker -

with the cheer squad and both the boys' and girls' basketball teams, and a weight room that only supports about a third of the team at a time.

Unknown Speaker -

It has small potatoes compared to what the football and track teams are forced to deal with on a daily basis with their current situation practicing at Lincoln. The amount of money and time spent busing the kids to and from England and getting home from practice and eating dinner after 9 p.m. as a parent frankly is unacceptable. And that's not to mention the loss of participants that both teams have suffered due to the problem of the practice team.

Unknown Speaker -

When I first heard the woes of Fon regarding Lincoln Field, I was appalled that nothing has been done in the four years since the ETA 5 levy has passed. As I learned more and more, I found that my anger was misplaced. After many years from the federal government, I know that interagency work is hard. This group should be applauded for their work up to this point. I see the dialogue between SPS, Seattle Parks, and the community as a model of interagency cooperation and community engagement.

Unknown Speaker -

We should join projects. With that in mind, I humbly implore you to approve the proposal as given in. Thank you.

Unknown Speaker -

Molly.

I think it may have gotten turned off again.

Yeah. Shuba.

Thank you.

Unknown Speaker -

My name is Molly Spence, I'm here today.

Unknown Speaker -

And thank you. It has been such a good discussion.

Unknown Speaker -

I am in North Welling for a community member. I live six blocks from the proposed option B. I am an advocate for Seattle's treaty canopy goals. I am also a long-time brother-rouser for the health of children and healthy outdoor sports for not just Lincoln students, and you've heard tonight about the number of Lincoln students, but also we haven't talked yet, I don't think, about Hamilton students who are also affected So that's 2,700 kids currently and their families who are all community members that went from this field. And then also, again, I'm like, mom, I make, you know, I serve dinner at 9.30 during football season because of the long commute that you've heard about. That's an inconvenience. But it's also, when you think about it, just all the families that are doing this all over town, all the gas, all the time, all the money, all the carpet, year upon year upon year. It's a really big deal, not just for us, but for the environment too. So let's consider that. So I think the proposal to move ahead is responsible. I think good points have been made about the process, the PIS process, what voters have voted for, the tough questions that, yes, we should ask along the way, we all should, because we all care about our community, we all care about trees. If anything, I just beg and plead for this to go faster. 20 sites. You've heard that? 20 sites. You've heard that? 20 sites. Years and years have gone into this. Hi, Dave, is there anything that can happen that can be expedited when we're thinking about all the impacts of all the people affected? I'd love for the time to get faster. Thank you. Hi, board members. I'm Hans Gordahl. I'm a neighbor of the park. I've been a voice in the room. I've been a voice in the room. I've been a member of my fellow community members.

Unknown Speaker -

I don't have a student in the school system, but I respect the need to balance all the distinctions that have the same parts. And, you know, there's a lot of hard trade-offs, right? You know, we heard, you know, for example, one key point to make is like, oh, you know, option A, but there's option A has legacy. So, we're a triad of it, non-negotiable. So, where do we turn, right? And in engaging with Seattle Public Schools on this process, it seems to me that the recommendation for activating the level five is a thoughtful recommendation that makes good progress to balancing the means of different constituencies and building a consensus, not uniform, like any structural imagination, but a consensus that could move the project forward at long rocks so you know it's part of this process so far as decision and discussion the center of gravity moves from Seattle public schools to the parts board um you know I said you know I speak as someone who would love to see the tree impacts mitigated at that gravel application but I think the gravel application is really you know far the perfect but you know pretty clear compromise And this process has turned me from energy that served to an energy support. So I want to put my voice in the room.

Thank you. Next up, . Hello, I'm a member of the School of Public Schools.

Unknown Speaker -

Thanks for having us meeting. My name is Nerva Bailo, I'm calling for a neighbor and a scout of the public schools' parents. I'm here to talk about the stewardship of Lower Woodrow's Heart. First, I'd like to say that I strongly support the Grab a Law Location Office for Lincoln's Field. Beyond that, I'd like to talk about the actual orientation of that field.

Unknown Speaker -

What I'd like to say is that the community option, which is similar to the diet field version that's on the record best spotting, is the best option. So that option removes fewer than 20 trees and preserves every large agro-graving, while option B, for example, removes more than 40 trees, including western red cedars, which can live over a thousand years. Option B also removes a mature tree-bought

Unknown Speaker -

fairgrounded field entirely, which puts the neighbors along the picnic directly against a parking lot by the food use. And with regards to parking, there are 170 parking spots that exist already in the picnic booth, so there's really not a need for more parking there. And about it, they're able to orient the field in a diagonal version and also it will allow the picnic booth to remain a culture of discussion, and that's really important for cross-country and for site-to-locross, they can store and use that space for their needs. So parks and public spaces work best when the people who use them on the ground help shape the outcome. We actually have a perfect example of this already in Wallingsburg

Unknown Speaker -

at the Northeastern Station. So that design was actually chosen and built for that facility.

Unknown Speaker -

That design came from a suggestion by a neighbor and SVU listened. And now we have this award-winning facility down there. So this is what happens when local knowledge as an asset and I think there's a lot of great local knowledge around this part for

Unknown Speaker -

independent users. And so as you're considering this, just think about what does tree mean at the space and choose a community option. Because it's going to say trees

Unknown Speaker -

and minimize neighborhood effects and provide amazing fields for Lincoln and our other Thank you.

Unknown Speaker -

Next up, Dr. George.

I'm Dr. Paul. My name is Dr. Paul. I'm a 50-year resident of Seattle.

Unknown Speaker -

I'm a former arborist in Seattle. I ran a tree service company for 20 years.

Unknown Speaker -

I stopped doing tree service in the City of Seattle, changed the tree ordinance laws to allow private contractors to cut down so many trees in Seattle.

Unknown Speaker -

We're talking about tree canopy in the parks. We're talking about school fields that are much needed. The problem doesn't lie in cutting down the fields in the parks. The problem lies in the City Council cutting down trees throughout the city. The problem also falls to the board members of the Seattle Public Schools by creating a school with 1,800 kids. You have other schools like Nathan Dale that are struggling to keep a population of 1,000 because you're sucking the talent out of those schools and shuffling them off to a school like Lincoln, which he claimed is a success only because you're funneling in the smartest kids in the entire city into that school. You're cutting away the community from other schools like Nathan Hill, like Ballard, and other schools like that, and drastically increasing the impact on the students at Lincoln, which is massively overcrowded. Kids don't even eat lunch in a lunchroom at Lenton. They eat it in the halls. They don't have a space to go. They obviously don't have a waiting room that supplies enough space for students to work out. These are all problems that were made by the Seattle City Council, by Seattle ordinances that were put in place. and that is the fundamental problem that has caused this argument between whether or not to build a field or leap trees up. So that's what I implore you to do is to go back to the roots and have some forethought as to what the future of our city is and fix the problems that are underlying causes.

Hello, I'm Tyler Fesey, ESCAL's parent and board member of Friends of Seattle Home City Arts. As a TOPS parent, I willingly travel further for my son's Elizabeth Frizzly games for which we do not have a home field. Despite having only a couple of sports, we all travel for it. He never plays a home game. As already mentioned, the EIS and required public process refers to subject matter experts for which we observed as such in many, many years, the program was done by Parks and Recreation. In contrast, when I address the mischaracterization of Friends of Seattle, Winston Parks' stance in SBS's documents, it's hard-line, and that we said none of these projects were fine in a legal issue. This is far from what we have done and the many, many hours and effort report by board members and advisors when their consultants suggest that option B was unlikely to be coax on. I can only imagine whether mischaracterization of public input is contained in that document. One does not mitigate removal of trees in forested areas. There will be ripple effects beyond the borders of this field. It would be important to continue evaluation of on site and serving rather than need to feel the measurements to be accommodated without harming the sower trees. Our on-site measurements indicate this might be possible, and we would like to continue to be engaged. It dramatically changes the character of heart as a place to feel, and this board needs to be said at that. Thank you.

Sarah, and then we'll call about a student. Hello, country stars. Thank you for the opportunity to speak tonight. My name is Sarah Campbell. I'm the head coach of Brains and Applias. We use the press country team at a screen created in the U.S. of Arts this night in Canada. Each year, we serve over 200 athletes aged 714, introducing normal runners to the sport. I want to begin by acknowledging the need for the high school to have access to a field, youth athletics matter. But the proposal to build the big students' fields and travel-off activities that have significant native consequences for the entire cross-country community in Seattle. Woodland Park is not just another green space. It is the only centrally located park in Seattle large enough to support a full 5k cross-country course. That means that they're replaceable. Our Arrata City San Diego course, established in 1989, is one of the oldest continuously used cross-country courses in the region. Woodland Park also hosts Metro League place school meets, including Metro Championships and Seeking District Championships, CYO Youth meets, College and Open Races, and USATM Youth meets. This park was used by thousands of runners every fall. It was a cornerstone of Seattle's running community. The gravel block off the field is not just a parking area, it was a primary access point to the cross-country practices and meets. Removing it would eliminate essential parking and force all traffic into the picnic pool. This would create major safety concerns as the course crosses the thing and looped multiple of times during both breakfast and needs. Introducing heavy traffic into an area where children are actively running is simply unsafe. Soccer and football are all sports just like most countries, and their feed usage with direct overlap with ours creating unavoidable conflicts. There are alternatives. Seattle already has many existing fields and many potential sites pretty much, but there is only one Brooklyn Park. Building a mixed-use field in this specific location would displace a decades-old running community, eliminate and disrupt course, and remove the only 7.5k venue available to youth and high school athletes. This is not a matter of choice choosing one sport over another. It is about recognizing that some spaces serve unique and replaceable parks. Woodland Park's role at Seattle's cross-community do not be overstated. Thank you for your time. Thank you. Yeah.

Susan Pendor. And next up is going to be your speaker.

Unknown Speaker -

My name is Susan Pendor and I'm both father and mother of the college high school practice. My daughter runs 1,600 track team named training runs to put them apart. On the really hot days some of the kids get hit with

Unknown Speaker -

heat exhaustion, my daughter being one of them.

Unknown Speaker -

And that was eight years ago. Since then, our city's gotten noticeably hotter and drier, the option to be with the largest number of trees on the farm. Under the column signing adverse impact to other users, there's no mention of the increase in air pollution,

Unknown Speaker -

the cost of stormwater mitigation, and the loss of transpiration. Transpiration is the often over-the-caracteristic trees of the office of the farm, you know this, but think about being outside on a hot day and a fan yourself, and you have a spritz of water. There's a heightened cooling sensation. One mature big leaf maple releases hundreds of gallons of water vapor on one bucket. One mature conifer releases upwards of 100 gallons per day. To remove this element from our atmosphere, it doesn't just impact people, but also the surrounding areas of vegetation. Small replacement trees for non-intuitive replacement trees require a lot more water than the first few years. Given our worsening heat and ground conditions, it means a lower likelihood of survival.

Unknown Speaker -

At this juncture of the climate crisis, decisions made today will determine how uncomfortable our future will be.

Unknown Speaker -

And while I've always been happy to improve school eddies, I do so with the expectation of a fun program and projects that will help us to make better future for our kids, and by extension, everyone in the community. Option B does not achieve that, because by problems we cost a myriad of levels. Climate change is a category, and the fact that faith and scientists have created it at on a future level of experience. Please consider a future board to ensure that you stay confident in the office.

Eric will be asked.

And Alex.

Unknown Speaker -

On behalf of a great number of people that asked for the discussion,

Unknown Speaker -

and have been asked for the and the design of the gravel lot.

Unknown Speaker -

I'm just kidding, hearing my kids, and she's been listening to this location.

Unknown Speaker -

Friends of Lilligan Park should have put forward a design that will take out more than 20 streams and it's all I'm sure ever gets to do this.

Unknown Speaker -

It requires certain compromises in the design, and that's what we hope you will focus on in this project. not whether it should be loaded with the ground a lot. It should happen, but whether it should be loaded with that.

Unknown Speaker -

And it can be loaded with that. First issue is whether there will be a parking path or a new drive with access to the field.

Unknown Speaker -

We simply go to the field, leverage picnic booth, adding paths to the picnic booth is not necessary. Parking needs that drive with access to the state. Dozens of cheats do not have that. Save and bring costs as well. The second issue is a width of the field, which is going to involve another dozen trees with a full width of 195 feet. A hundred to eighty feet must be adequate and successful as this room is going to be option A.

Unknown Speaker -

It should be adequate and acceptable for option B as well.

Unknown Speaker -

If you orient the field correctly, eliminate added parking, and leverage 170 parks cost effective, It takes out 16 trees and leaves all of our veterans in place. Thank you.

Unknown Speaker -

Alex?

I'm a proud member of Garvey and I'm a Asian alum and I went to Navy and graduated from I spent four years of arts soccer at Garfield, and during those years Garfield did not have a dedicated school. We actually practiced here at Mellor on Syntricks, and we put our home base at the Memorial Stadium. memories from the summer of recording they have nothing to do with the suggested French ! They have nothing to do in the suggested hardship of or inconvenience of going to other sports fields to play by games or practices. ! I really urge you to reconsider the proposal that would remove some mature healthy trees to build this new athletic field. ! I'm learning a lot about alternative proposals and I think there's still things that should be on the table with option A. ! These trees and the ecosystem services they provide are effectively irreplaceable. Even if replacement trees are planted, as many mentioned, it will take decades for them to provide the same shade while they have habitat. actactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactact for them to provide the same shade, wildlife habitat, and a normal pilot and a female guarantee they will. Research on urban heat violence is clear. Replacing a mature tree canopy with synthetic turf will increase heat in the state of it at a time when cities should be investing cooler, greener public spaces. These trees are also valuable to many people beyond athletes. They are part of the daily experience of students, neighbors, runners, artists, children, and everyone who finds unique refuge and connection in this place. They also support countless birds, insects, and wildlife. Most importantly, this is an opportunity for our public to help institutions to align our actions with our values. The land acknowledgement that was read tonight and that the institution of Seattle reads with some intention of fidelity speak to caring for this land for future generations. I think this is a moment to align those words with our needs and actions and decisions. Thank you.

And Martha? I must admit, I thought it was going to be the last month. Thank you. So I am the head football coach for Hamilton. There is someone besides Molly talking for Hamilton. I have been, you know, reinventing what I was going to say because everyone has to speak so well, including those who are advocating for the trees, which I'm sure we all love. So, listen, I appreciate your word, commissioners. I don't envy it. All I'm asking is to find a way to get this done. By some of the comments I've seen on social media and some of the things I've heard today, you would be thinking that we're proposing to build a whole processing plant or something. So, you know, yes, I don't know if there's a way to save all the trees. If there is, please do that one and not do another one that mitigates the least amount of trees, but just please build a field. Like, we need it. Our students need it. I have to walk students all the way from Hamilton across to SDS, have the risk of getting, you know, talking about sixth graders that are covering their bearings. like we need a field right and it's not just for the students the community also coach club soccer we're always tight on fields there so find a way I know there's space I'm sorry like I really hope that there's a way that no tree will impact it but if there's a few trees I'm sure the community will find a way to make it up to them we can be creative we can find other ways to provide a positive environmental impact and still build a field thank you for your patience Thank you all. I still love you. You're my neighbors. All good.

Greetings, our commissioners, and if you're in there tonight, thank you for the comments.

Unknown Speaker -

And here are my thoughts. We already paid the parking lot that was put in the 1980s model for the previous field was taken over.

Unknown Speaker -

And now this proposal is to take the public sports department to move classes in our fields.

Unknown Speaker -

I really do want the students to be happy and deprived and not have such stretched schedules. They absolutely have that right. removing our apartment and the minimum pH trees and wildlife is not answered. We actually haven't seen a tree in the toilet, so that's a bit of a guess for our end. And it doesn't even need to account for the neighboring trees. We all can recall how hot it is this week and certainly how hot it is in the room. The latest outlook from NOAA's Climate the Dixon Center shows that Seattle would end up a formal cap summer. If this project moves forward, we are teaching children that killing trees, birds, wildlife, destroying nature, and denying climate change is okay.

Unknown Speaker -

There is a bill on the table of City Council's vote for 1500 moves of public rights to the

Unknown Speaker -

It is not that straight forward to that aspect.

Unknown Speaker -

The proposal drastically degrades the park.

Unknown Speaker -

Will it still be called Woodland Park? While the proposal potentially addresses the sports code issue, the permanent impact is irreversible and damages the well-being and health of all our residents.

Unknown Speaker -

Please make a difficult decision to find a different local, smaller footprint, and protect our environment and health for generations. Thank you.

Unknown Speaker -

Mark is happy. Unqualified back.

Unknown Speaker -

Sorry. And so the next time you come up here. My name is Mark Homan.

Unknown Speaker -

I'm a double-clean parent, also a coach.

Unknown Speaker -

Don't worry, this didn't happen during practice. It's actually really kind of funny because I'm a debate coach.

So while I'm speaking as a debate coach, I'm a new coach. This is my first year doing it, and I just wanted to give you a window into what I've seen, the impact that after-school activities, especially athletics, have on the kids. I've seen kids absolutely transformed by these activities. And there's such large debates going on here tonight that I just wanted to ask you to focus on the impact that this has on kids and what it helps these kids respect in terms of themselves and their school and their city and civics and engagement. And it's so much more than playing sports. And as a small team or a small debate team, I also wanted to encourage you during the review process, please keep in mind all the sports, all the requirements. Because the pride these students have in these activities is tremendous. And to give them a supportive environment where they can have these activities is a tremendous value. So thank you very much for all the experience. Thank you for your time.

Unknown Speaker -

Thank you. Thanks for joining us today. I think it was awesome.

Unknown Speaker -

Teched.

Unknown Speaker -

Watched. We had a summer.

I'm glad to hear that you are going to address mitigation and tree concerns, but in this planet, I do not believe you can mitigate the process of a bus, which are an exception to trees. You know, the best protectors from all other animals, planet farms, and I really just wanted I want to say it is critical to be able to feel in such a manner that we protect, serve our urban forests, and move our ecosystems and decrease climate risks. We're in the park as one of our state's most touched in this case.

Once hundreds of euros take a bond, you know, just a lot.

Thank you.

Unknown Speaker -

Thank you.

Unknown Speaker -

My name is Beth. I've lost another long time.

I'm also concerned about the trees may impact on potential removal of mature, healthy, native Seattle trees that are really

Unknown Speaker -

the legacy of this city, or the Emerald City, and I fear we'll lose that title.

These are mature trees that provide habitat both below ground and above ground. These are trees that mitigate climate change as has been described before and improve our air quality. These are also trees that we know improve the mental well-being when we work around them. So I want to recognize and acknowledge the mental health benefits of exercise and participating

Unknown Speaker -

but there are also mental health and well-being benefits of being in the

Unknown Speaker -

presence of these mature healthy trees. These mature trees also support the forest around them through the complex system underneath the ground that we're learning about. So it's not so easy to screw these trees and expect young trees to grow because you've lost this underground support from these mature trees. Finally unique tree removal really means that Seattle is at odds with the Seattle comprehensive plan of just last year to increase Seattle tree canopy so any trees can cut down how it is, the honors, the depth goal. Thank you.

Unknown Speaker -

Hello, my name is Anne. I've been 30 years that I've been involved in that arts system, either as a community member and or arts department, but I believe this is one of the most important of the city's department of the past year. The recommendation will further change the Wigland Park, the loss of the intended Wigland space for the health of our city and the rest of the past. The lack of site-specific information provided with a screenshot. More answers are needed for the department of the and knowledge to both. In terms of the EIS, we'll help answer these questions. But the EIS process is designed primarily for the education, rather than evaluate the best solution, especially if there's only one option. More on-site specific details, and still the evaluations, there are scenarios for the

Unknown Speaker -

learning to perform the units.

Unknown Speaker -

Continuing to evaluate the A site provides potential alternative to the best instructor, particularly if park so it's more built to be adjusted to the service. Assumptions have been built into the project today to be examined. The school district mission is to build athletic field, not to protect any current resources. The process needs to look at the park space, the home, to determine how to best develop quality needs. The school district also needs to demonstrate to press budget action bill and maintain a budget that meets those needs. At this point, the Park Department is aiming for moving the PIS process to the schools. This is not acceptable for such a major international budget. It is that Park Commissioners must ask our questions for both the school district and the Park Department. We are the public stewards of our Park system. I need to be involved in all steps along the way, not just give a blessing. Just as a message.

Hey, everybody. Thanks for listening. I have school-aged kids, and I also work for Seattle Public Schools. I'm out there during the hot recess times. And I'm also speaking as a community member because I see that our parks are for the people of our state. And there are a lot of other people that use the green parks. And I believe that all kids should be able to move the way they want to. But what I have seen working in the school, and I saw it this year when we had some very hot days, before school got out, is that we had to bring our kids in from recess. And it wasn't like it was full in the room, but we had to stop them from moving so much. One kid almost passed out, and we had to have them sit and play, you know, at the table with their hands because it was hot. It was, there was no shade. There were trees that had been cut down on the playground and had not been replaced. So I don't trust Seattle Public Schools and stewardship of trees. I'm always trying to stand under them during recess. But the point is that when our kids, a lot of us have kids, when they have kids, those kids are going to be asking, why can't I go outside and play more? I'm already steaming at school. So I would like you to... I'm already seeing it's so I would like you to explore the overall impact of what people have said about the climate impact of these trees. Thank you very much.

Unknown Speaker -

! Thank you for ! Thank you for ! Thank you for everyone for

Unknown Speaker -

actactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactact

Unknown Speaker -

especially appreciate the respect everyone showed to each other for both time and the diversity of

Unknown Speaker -

comments perspectives really appreciate that so as a board thank you for that

um just next steps on yeah next steps on this please if you have additional comments or anyone If anyone else is interested in coming, you submit written comments. We will get them all.

Unknown Speaker -

They should read regularly to us as board members, and then we will take this issue up, I believe, on our next August 13th, our next regularly scheduled meeting.

Unknown Speaker -

Which is here again because we're doing some improvements to our tech at our Dexter location.

Unknown Speaker -

Oh, okay. I didn't know that. So we will be here again on August 13th.

Unknown Speaker -

All right. Thank you, and we'll have a briefing, discussion,

Unknown Speaker -

and a possible vote at that time. Thank you all for coming this evening and sitting in a hot room.

All right. And I have a question.

Video

Reference

No documents are available for this meeting yet.